February 27, 2009

Y chromosome of Tsar Nicholas II

The Y-chromosome haplotype of the Tsar appears to belong to haplogroup R1b. Interestingly, they were able to get the Tsar's DNA from a bloodstained shirt:
In 1890–1891 Nicholas II, then-heir to the throne was on an around-the-world voyage. On 11 May 1891, during his visit to Osaka, Japan, he was attacked and injured in an apparent assassination attempt. The escort policemen swung at Nicholas II’s head with a saber; however the following blow was parried by Prince George of Greece and Denmark who was accompanying Nicholas II. Although the wound was not life-threatening, Nicholas II was severely bleeding and a long scar remained on the right side of his forehead.


Interestingly (not mentioned in the article), Nicholas II and his savior Prince George shared patrilineal ancestry, as they were both descended from Frederick I of Denmark. Thus, it seems (barring any "accident") that the dynasty founded by King George I of the Hellenes would also belong in haplogroup R1b.

In this paper, they were able to test descendants of Nicholas I of Russia, so the line appears to be secure at least that far in the past.

The supporting information is online. The mtDNA of the Tsarina Alexandra and the children ("Queen Victoria type") is:

16111T 16357C 16519C

and of the Tsar:

16126C 16294T 16296T 16519C with either 16169C or 16169T

I will look up the haplogroup prediction when I have time, but feel free to post in the comments.

PNAS doi:10.1073/pnas.0811190106

Genomic identification in the historical case of the Nicholas II royal family

Evgeny I. Rogaev et al.

Abstract

Accurate unambiguous identification of ancient or historical specimens can potentially be achieved by DNA analysis. The controversy surrounding the fate of the last Russian Emperor, Nicholas II, and his family has persisted, in part, because the bodies of 2 children, Prince Alexei and 1 of his sisters, have not been found. A grave discovered in 1991 contained remains putatively identified as those of the Russian Royal family. However, not all family members were represented. Here, we report the results of genomic analyses of new specimens, the human remains of 2 burned skeletons exhumed from a grave discovered in July 2007, and the results of a comprehensive genomic analysis of remains from the 1991 discovery. Additionally, ≈117 years old archival blood specimens from Nicholas II were obtained and genotyped, which provided critical material for the specific determination of individual identities and kinship identifications. Results of genotypic analyses of damaged historical specimens were evaluated alongside samples from descendants of both paternal and maternal lineages of the European Royal families, and the results conclusively demonstrate that the recently found remains belong to children of Nicholas II: Prince Alexei and his sister. The results of our studies provide unequivocal evidence that the remains of Nicholas II and his entire family, including all 5 children, have been identified. We demonstrate that convergent analysis of complete mitochondrial genome sequences combined with nuclear DNA profiles is an efficient and conclusive method for individual and kinship identification of specimens obtained from old historic relics.

Link

February 20, 2009

Auton et al. on Global distribution of genomic diversity

The full supplementary materials from this study are not online yet [UPDATE (May 2): You can read my comments on the suppplement here]. This seems to be based on a presentation from ASHG 2008. As I explained in that post, because Europe was settled from the east, it is expected that genomic diversity (left) would be higher in SE Europe and lower in SW Europe. However, the opposite is true. This, coupled with the observation of a higher degree of haplotype sharing between SW Europe and the Yoruba HapMap sample, suggests that genomic diversity in the Iberian peninsula has been enriched directly from Africa.

The STRUCTURE analysis is not quite clear, but clusters centered in Europe, Mexico, South Asia, East Asia, and Yoruba appear. From the figure, it appears that a little bit of "South Asian" appears in Europe, which may represent either a Gypsy element, or the more general "light blue" element which appeared in Li et al. Figure B, shows variability of Mexicans, who are mainly a European-Amerindian mix. Figure B distinguishes between Japanese and Chinese. Figure D distinguishes between Dravidian and non-Dravidian South Asians.
The POPRES sample has been previously used in a study on geography and genetic structure in Europe.

Genome Research doi:10.1101/gr.088898.108

Global distribution of genomic diversity underscores rich complex history of continental human populations

Adam Auton et al.

Abstract

Characterizing patterns of genetic variation within and among human populations is important for understanding human evolutionary history and for careful design of medical genetic studies. Here, we analyze patterns of variation across 443,434 SNPs genotyped in 3,845 individuals from four continental regions. This unique resource allows us to illuminate patterns of diversity in previously under studied populations at the genome-wide scale including Latin America, South Asia, and Southern Europe. Key insights afforded by our analysis include quantifying the degree of admixture in a large collection of individuals from Guadalajara, Mexico; identifying language and geography as key determinants of population structure within India; and elucidating a North-South gradient in haplotype diversity within Europe. We also present a novel method for identifying long-range tracts of homozygosity indicative of recent common ancestry. Application of our approach suggests great variation within and among populations in the extent of homozygosity suggesting both demographic history (such as population bottlenecks) and recent ancestry events (such as consanguinity) play an important role in patterning variation in large modern human populations.

Link

February 18, 2009

Estimating degree of Native American admixture from faces

Klimentidis and Shriver have a new paper which looked at the concordance between people's perception of Native American admixture and their actual admixture estimated from ancestry informative markers. Overall, observers' ratings were non-random, indicating that they could indeed estimate ancestry from facial appearance. They were, however, closer to random than to the actual admixture proportion, indicating a great degree of "noise" in the estimate. Interestingly, Europeans estimated admixture more accurately than Native Americans, although they tended to overestimate it, while Native Americans tended to underestimate it.

Some related posts on appearance-ancestry correlations from the Shriver lab.


PLoS ONE doi:10.1371/journal.pone.0004460

Estimating Genetic Ancestry Proportions from Faces


Yann C. Klimentidis, Mark D. Shriver

Abstract

Ethnicity can be a means by which people identify themselves and others. This type of identification mediates many kinds of social interactions and may reflect adaptations to a long history of group living in humans. Recent admixture in the US between groups from different continents, and the historically strong emphasis on phenotypic differences between members of these groups, presents an opportunity to examine the degree of concordance between estimates of group membership based on genetic markers and on visually-based estimates of facial features. We first measured the degree of Native American, European, African and East Asian genetic admixture in a sample of 14 self-identified Hispanic individuals, chosen to cover a broad range of Native American and European genetic admixture proportions. We showed frontal and side-view photographs of the 14 individuals to 241 subjects living in New Mexico, and asked them to estimate the degree of NA admixture for each individual. We assess the overall concordance for each observer based on an aggregated measure of the difference between the observer and the genetic estimates. We find that observers reach a significantly higher degree of concordance than expected by chance, and that the degree of concordance as well as the direction of the discrepancy in estimates differs based on the ethnicity of the observer, but not on the observers' age or sex. This study highlights the potentially high degree of discordance between physical appearance and genetic measures of ethnicity, as well as how perceptions of ethnic affiliation are context-specific. We compare our findings to those of previous studies and discuss their implications.


Link

19th century trumps 21st (for predicting height)

What this study has found is that predicting a person's height from that of his parents is much more accurate than predicting it from all discovered height-related genetic loci combined.

Of course, we need to pursue genomics, since that is the only way in which we will eventually learn how height is inherited, and which biological factors affect growth. But, for practical purposes, and for the foreseeable future, I doubt that we'll get more information about a baby's prospects by looking at its genes, than by looking at its family.

For some background on the underwhelming results of genomics see In search of the hidden heritability.

European Journal of Human Genetics advance online publication 18 February 2009; doi: 10.1038/ejhg.2009.5

Predicting human height by Victorian and genomic methods

Yurii S Aulchenko et al.

Abstract

In the Victorian era, Sir Francis Galton showed that |[lsquo]|when dealing with the transmission of stature from parents to children, the average height of the two parents, |[hellip]| is all we need care to know about them|[rsquo]| (1886). One hundred and twenty-two years after Galton's work was published, 54 loci showing strong statistical evidence for association to human height were described, providing us with potential genomic means of human height prediction. In a population-based study of 5748 people, we find that a 54-loci genomic profile explained 4-6% of the sex- and age-adjusted height variance, and had limited ability to discriminate tall|[sol]|short people, as characterized by the area under the receiver-operating characteristic curve (AUC). In a family-based study of 550 people, with both parents having height measurements, we find that the Galtonian mid-parental prediction method explained 40% of the sex- and age-adjusted height variance, and showed high discriminative accuracy. We have also explored how much variance a genomic profile should explain to reach certain AUC values. For highly heritable traits such as height, we conclude that in applications in which parental phenotypic information is available (eg, medicine), the Victorian Galton's method will long stay unsurpassed, in terms of both discriminative accuracy and costs. For less heritable traits, and in situations in which parental information is not available (eg, forensics), genomic methods may provide an alternative, given that the variants determining an essential proportion of the trait's variation can be identified.

Link

February 17, 2009

Y-chromosomes of Mormon founders and HapMap Utahns

Feel free to post in the comments, any information you can deduce from these haplotypes (haplogroup, origin, etc.)
 Am J Hum Genet. 2009 Feb;84(2): 251-8

Inferential genotyping of Y chromosomes in Latter-Day Saints founders and comparison to Utah samples in the HapMap project.

Gitschier J.

One concern in human genetics research is maintaining the privacy of study participants. The growth in genealogical registries may contribute to loss of privacy, given that genotypic information is accessible online to facilitate discovery of genetic relationships. Through iterative use of two such web archives, FamilySearch and Sorenson Molecular Genealogy Foundation, I was able to discern the likely haplotypes for the Y chromosomes of two men, Joseph Smith and Brigham Young, who were instrumental in the founding of the Latter-Day Saints Church. I then determined whether any of the Utahns who contributed to the HapMap project (the "CEU" set) is related to either man, on the basis of haplotype analysis of the Y chromosome. Although none of the CEU contributors appear to be a male-line relative, I discovered that predictions could be made for the surnames of the CEU participants by a similar process. For 20 of the 30 unrelated CEU samples, at least one exact match was revealed, and for 17 of these, a potential ancestor from Utah or a neighboring state could be identified. For the remaining ten samples, a match was nearly perfect, typically deviating by only one marker repeat unit. The same query performed in two other large databases revealed fewer individual matches and helped to clarify which surname predictions are more likely to be correct. Because large data sets of genotypes from both consenting research subjects and individuals pursuing genetic genealogy will be accessible online, this type of triangulation between databases may compromise the privacy of research subjects.

Link

Psychological well-being of multiracial individuals

This study demonstrates that multiracial individuals who identify with the different components of their ancestry have equal or better psychological well-being compared to those who identify with only one of them.

I had predicted as much back in 2003:
The offspring of mixed marriages often adopt two different types of coping strategy to deal with their own 'identity' problem, created both because they're not sure "what" they are, and also because society is not clear "what" they are.

Strategy #1, is to shut off one part of one's ancestry. [...] Strategy #2, is to identify with the common denominator of the two parts. [...] BTW there is of course Strategy #3 (which I think is the psychologically soundest one): to acknowledge one's hybridity rather than trying to pretend that the parts are the same (#2) or by turning a blind eye towards one of them (#1)

Journal of Social Issues
Volume 65 Issue 1, Pages 35 - 49

The Interpretation of Multiracial Status and Its Relation to Social Engagement and Psychological Well-Being doi:

Kevin R. Binning et al.

Abstract

This research examines how multiracial individuals chose to identify themselves with respect to their racial identity and how this choice relates to their self-reported psychological well-being (e.g., self-esteem, positive affect) and level of social engagement (e.g., citizenship behaviors, group alienation). High school students who belong to multiple racial/ethnic groups (N = 182) were asked to indicate the group with which they primarily identify. Participants were then classified as identifying with a low-status group (i.e., Black or Latino), a high-status group (i.e., Asian or White), or multiple groups (e.g., Black and White, etc.). Results showed that, compared with multiracial individuals who identified primarily with a low- or high-status group, those who identified with multiple groups tended to report either equal or higher psychological well-being and social engagement. Potential explanations and implications for understanding multiracial identity are discussed.

Link

February 16, 2009

Forensic study of Hungarian Y-chromosomes

My tabulation of the haplogroup composition is in the figure. The last four haplogroups that aren't very visible occur at a frequency of 0.9, 0.5, 0.5, 0.5% respectively. Nothing too surprising about these results, except for the H1 which probably represents the Gypsy element, and R2 which may be both of South Asian Gypsy or Central Asian/Siberian origin. The lone example of haplogroup N, which was found in 2 of 4 ancient Magyars confirms the low genetic influence of the original Magyars on present-day Hungarians.

It is also fairly interesting that comparatively, Bulgarians end up as being closest to Hungarians, with a negative Fst value. Perhaps this represents some commonality of an Asian element added to a Balcano-Danubian population. Non-significant differences (above 5% level) were also observed in comparison to Romanians, Slovenians, Ukrainians, and surprisingly Norwegians, perhaps due to the fairly unusual high R1a/R1b mix in both populations.

Forensic Sci Int Genet. 2009 Mar;3(2):e27-8.

Hungarian population data for 11 Y-STR and 49 Y-SNP markers.

Völgyi A, Zalán A, Szvetnik E, Pamjav H.

49 Y-chromosomal single nucleotide polymorphisms (SNPs) with TaqMan assay and 11 Y-chromosomal STR loci were tested in 215 independent Hungarian male samples. Genetic distances to 23 other populations were calculated based on haplogroup frequencies with AMOVA implemented in Arlequin2.0. Based on distances phylogenetic tree was constructed with Neighbor-joining method using Phylip 3.66. Haplotype and haplogroup diversity values were calculated.

Link

February 15, 2009

Facial anthropometry correlates with admixture proportions in African Americans

If you doubt that facial measurements can be used to determine racial makeup, feel free to use my old black-or-white calculator, which determines the chance that a given individual is Caucasoid or Negroid - rather than admixture proportions as in this study. I would be interested to hear of biracial individuals' results though, so send me an e-mail. Quite often, people don't take accurate measurements, though, so if you get an unexpected result, the odds are that you're measuring something wrong.

Mixed Population Provides Insights Into Human Genetic Makeup
The researchers looked at a combined sample of African Americans with West African and European ancestry whose genetic makeup was known through DNA testing. To make it simpler, anyone with Native American ancestry was eliminated so that only two genetic pools were represented -- West African and European. The researchers reported on a sample of 254 individuals using three-dimensional imaging and measured the distances between specific portions of the face. Each individual had provided a DNA sample.

...

From their DNA profiles, Shriver could determine the admixture percentages of each individual, how much of their genetic make up came from each group. He could then compare the genetically determined admixture to the facial feature differences and determine the relative differences from the parental populations.

...

Shriver found that there was a very strong statistical correlation between the amounts of admixture and the facial traits.

February 13, 2009

Microsatellite-based molecular clock is pretty good

This paper aims to vindicate the utility of microsatellites (STRs) as a molecular clock, by comparing estimates of time from sequence alignments with those from STRs.

Sequence alignments are direct reads of the letters of DNA, e.g.,

AGCTTAC
AGCCTAC

Longer times of separation => more spots were sequences differ.

Microsatellites are small stretches of DNA (a few bases) where a segment can exist in multiples, e.g.,

GATAGATAGATAGATAGATAGATAGATAGATAGATAGATA
GATAGATAGATAGATAGATAGATAGATA

The alleles for the above case are 10 and 7, respectively, since there are so many repetitions of the GATA element.

Theory suggests that average squared distance (or (10-7)^2 = 9 for this case) should scale linearly with time, under the symmetric stepwise model, in which length increases and decreases are equiprobable and independent of allele length.

However, deviations from the stepwise model may upset this linearity, if e.g., mutations are length-dependent, e.g., if they occur more frequently if the original allele is 10 rather than 7, or if there are range restrictions in allele length, i.e., very few or too many number of repeats are "forbidden" by the chemistry of the mutation process.

What this paper does, is to show that time estimates from sequence divergence are linearly related to time estimates from microsatellites using ASD:
Sequence divergence and microsatellite ASD are linearly related: The regressions have correlation coefficients all greater than 0.97. Since sequence divergence is known to be proportional to tMRCA, microsatellite ASD is linear to tMRCA. Interestingly, however, the regression lines do not intersect the origin, a point we return to below.
The "information content" of the two types of system is quantified:
1 microsatellite is “worth” approximately 10 Kb of shotgun sequencing, which is expected to contain 10 nucleotide mutations between 2 modern humans.

Interestingly:
The microsatellite molecular clock appears to be linear for at least 2 million years ... Therefore, encouragingly, the duration of ASD linearity is at least 10 times that of theoretical predictions, suggesting range constraints are not as severe as previously imagined.
Of course, linearity may be exhibited only in the time window examined. This paper conclusively proves linearity across a particular range, but not for times outside this range (younger or older). For zero sequence divergence, the regression has non-zero ASD, which suggests a non-linear relationship for younger divergence times.

The authors give two explanations for the non-zero intercept: a technical one about miscalling of heterozygous genotypes for homozygous, and a theoretical one which I prefer:
Alternatively, the relationship between ASD and tMRCA could be globally nonlinear, but easily linearizable in our time window. Whatever the cause for our observations, these results indicate that for population genetic analysis, it is important to use a calibration curve (such as Figure 1) to convert ASD to sequence divergence, correcting for the inflated estimate of divergence time from microsatellite ASD.

By "calibration curve" (the above Figure 1), they mean a way in which to go from ASD to sequence divergence/time; in the time window considered, ASD increases at a constant rate with time, but the non-linearity suggests a different rate of increase for younger times, indeed a steeper one.

Another interesting aspect raised is that microsatellites are less subject to ascertainment bias. If a single-letter is found to be polymorphic in population A, then it is not clear that it will also be polymorphic in population B. Therefore, if SNPs are "discovered" primarily in population A, then A will appear to be more "diverse" than B. This is not a problem, however, with microsatellites, since these mutate much faster, and an STR that is polymorphic in A, will also be polymorphic in B.

In conclusion, this is a very nice paper which vindicates the use of microsatellite-based age estimation, while raising some important concerns. In a few years, this whole debate may, however, be less important, since whole genomes will be sequenced economically.

However, with a back-of-a-napkin type of calculation, 150,000 polymorphic microsatellites in the human genome are "equivalent" (using 10kb/microsatellite; see above) to 1.5billion base pairs, or half the human genome. Probably many of these microsatellites won't be as informative or amenable to study as the small set sampled here, but in any case, this serves to demonstrate that microsatellites may still be relevant as an auxiliary source of information after whole genome sequencing becomes routine.


Molecular Biology and Evolution, doi:10.1093/molbev/msp025

Microsatellites are molecular clocks that support accurate inferences about history

James X. Sun et al.

Microsatellite length mutations are often modeled using the generalized stepwise mutation process, which is a type of random walk. If this model is sufficiently accurate, one can estimate the coalescence time between alleles of a locus after a mathematical transformation of the allele lengths. When large-scale microsatellite genotyping first became possible, there was substantial interest in using this approach to make inferences about time and demography, but that interest has waned because it has not been possible to empirically validate the clock by comparing it to data in which the mutation process is well understood. We analyzed data from 783 microsatellite loci in human populations and 292 loci in chimpanzee populations, and compared them to up to one gigabase of aligned sequence data, where the molecular clock based upon nucleotide substitutions is believed to be reliable. We empirically demonstrate a remarkable linearity (r2 > 0.95) between the microsatellite average squared distance (ASD) statistic and sequence divergence. We demonstrate that microsatellites are accurate molecular clocks for coalescent times of at least two million years. We apply this insight to confirm that the African populations San, Biaka Pygmy, and Mbuti Pygmy have the deepest coalescent times among populations in the Human Genome Diversity Project. Furthermore, we show that microsatellites support unbiased estimates of population differentiation (FST) that are less subject to ascertainment bias than single nucleotide polymorphism (SNP) FST. These results raise the prospect of using microsatellite data sets to determine parameters of population history. When genotyped along with SNPs, microsatellite data can also be used to correct for SNP ascertainment bias.

February 12, 2009

Bacteria and the human peopling of the Pacific

A new paper in Science looks at the peopling of the Pacific from the perspective of genetic diversity of the bacterium H. pylori which is found in people's stomachs.

Related to: Bayesian phylogenetics of languages and the timing of Austronesian settlement of the Pacific from Taiwan

Science doi:10.1126/science.1166083

The Peopling of the Pacific from a Bacterial Perspective

Yoshan Moodley et al.

Abstract

Two prehistoric migrations peopled the Pacific. One reached New Guinea and Australia, and a second, more recent, migration extended through Melanesia and from there to the Polynesian islands. These migrations were accompanied by two distinct populations of the specific human pathogen Helicobacter pylori, called hpSahul and hspMaori, respectively. hpSahul split from Asian populations of H. pylori 31,000 to 37,000 years ago, in concordance with archaeological history. The hpSahul populations in New Guinea and Australia have diverged sufficiently to indicate that they have remained isolated for the past 23,000 to 32,000 years. The second human expansion from Taiwan 5000 years ago dispersed one of several subgroups of the Austronesian language family along with one of several hspMaori clades into Melanesia and Polynesia, where both language and parasite have continued to diverge.

Link

February 10, 2009

Y chromosomes and surnames in Britain

From the paper:
Some haplogroups that are rare (less than 10%) or absent in the controls exist at high frequencies within particular surnames: examples are hgA1a in R., E1a in Bray, G in Wadsworth, J2 in Ketley, T in Feakes, Q* in Mallinson, R1* in Northam, and R1a in Swindlehurst (Figure 2a). Attenborough provides the clearest signal of coancestry, with 87% of chromosomes belonging to hgE1b1b1, which is present at only 1% in controls.
Of interest:
Direct analysis of Y-STR haplotypes in father-son pairs gives mutation rate estimates around 2.1 x 10-3 per STR per generation (Gusmão et al. 2005), while an
‘evolutionary’ rate based on diversity accumulated in specific lineages within
populations (Zhivotovsky et al. 2004) provides a rate some three times lower,
at 6.9 x 10-4.

...

We therefore chose to estimate a mutation rate by typing the 17 Y-STRs in a set of deep-rooting pedigrees totalling 274 transmissions of the Y chromosome, and with a mean pairwise separation within all pedigrees of 5.6 generations (Supplementary Figure 2). This gave a rate of 1.5 x 10-3 per STR per generation. Figure 5 shows
the mean and standard deviations of ages for a total of 74 clusters based on
these parameters.

One would need to look at the specific set of markers to derive a relationship between this "King & Jobling" (KJ) mutation rate, but it appears to be ~0.75 of the germline mutation rate. In the first post of my Y-STR series, I argued that Y-STR variance (not identical, but related to the ρ measure used here) accumulates at near the germline rate. The KJ estimate seems closer to the germline rate than to the ~0.3 (slow) Zhivotovsky et al. mutation rate. Note also that the age estimates for relatively young groups (first figure in this post) tend to be underestimates (1:1.17 for the youngest data point), which further supports the thesis that Y-STR diversity accumulates at near (but not exactly) the germline rate.

Note also that the time depth of British surnames is not too widely different from the populations used by Zhivotovsky et al. (Bulgarian Gypsies, Maori) for calibration of their evolutionary mutation rate. Therefore, it appears that the Zhivotovsky et al. rate is inconsistent with British surnames, and this underscores the difficulties with archaeological calibration of the mutation rate I talked about here.

Molecular Biology and Evolution doi:doi:10.1093/molbev/msp022

Founders, drift and infidelity: the relationship between Y chromosome
diversity and patrilineal surnames


Turi E. King and Mark A. Jobling

Abstract

Most heritable surnames, like Y chromosomes, are passed from father
to son. These unique cultural markers of coancestry might therefore have a
genetic correlate in shared Y chromosome types among men sharing
surnames, although the link could be affected by mutation, multiple
foundation for names, nonpaternity, and genetic drift. Here, we demonstrate
through an analysis of 1678 Y-chromosomal haplotypes within 40 British
surnames a remarkably high degree of coancestry that generally increases as
surnames become rarer. On average, the proportion of haplotypes lying
within descent clusters is 62%, but ranges from zero to 87%. The shallow timedepth of many descent clusters within names, the lack of a detectable effect of
surname derivation on diversity, and simulations of surname descent suggest
that genetic drift through variation in reproductive success is important in
structuring haplotype diversity. Modern patterns therefore provide little
reliable information about the original founders of surnames some 700 years
ago. A comparative analysis of published data on Y diversity within Irish
surnames demonstrates a relative lack of surname frequency dependence of
coancestry, a difference probably mediated through distinct Irish and British
demographic histories including even more marked genetic drift in Ireland.

Link

February 09, 2009

According to Flynn, nutrition not behind "Flynn effect"

See a recent paper by Lynn where the importance of nutrition for the Flynn effect (secular increase in IQ) was argued. Another paper on Denmark (and another) which also sees a recent decline in IQ scores, a reversal of the Flynn effect.

From this paper's conclusions:
The totality of the evidence supports a summary conclusion. Enhanced
nutrition has made us taller people and poor nutrition has made us more obese. But
our diet today probably does not make us very different people from our grandparents as far as cognitive competence is concerned. Our brains have altered since 1900, and they are better brains for solving the problems of our time. But they have altered rather like a muscle, that is, they have altered because we use them differently than our parents and grandparents did. The causes of this are many and the effects of nutrition, at least since privation has been banished, are too weak to stand out from the crowd.


Economics & Human Biology doi:http://dx.doi.org/10.1016/j.ehb.2009.01.009

Requiem for nutrition as the cause of IQ gains Raven's gains in Britain 1938 to 2008

James R. Flynn

Abstract

The hypothesis that enhanced nutrition is mainly responsible for massive IQ gains over time borrows plausibility from the height gains of the 20th century However, evidence shows that the two trends are largely independent. A detailed analysis of IQ trends on the Raven's Progressive Matrices tests in Britain dramatizes the poverty of the nutrition hypothesis. A multiple factor hypothesis that operates on three levels is offered as an alternative instrument of causal explanation.

The Raven's data show that over the 65 years from circa 1942 to the present, taking ages 5 to 15 together, British school children have gained 14 IQ points for a rate of 0.216 points per year. However, since 1979, gains have declined with age and between the ages of 12 to 13 and 14 to 15, small gains turn into small losses. This is confirmed by Piagetian data and poses the possibility that the cognitive demands of teenage subculture have been stagnant over perhaps the last 30 years.

Link

Body mass index and income in Europe

There seems to be some variation in the strength of the effect, but overall the finding is that women with higher BMI (heavier for their height) tend to make less money than slimmer women.

Economics and Human Biology doi:10.1016/j.ehb.2009.01.006

Income and Body Mass Index in Europe

Jaume García Villar and Climent Quintana-Domeque

Abstract

The problem of obesity is alarming public health authorities around the world. Therefore, it is important to study its determinants. In this paper, we explore the empirical relationship between household income and body mass index (BMI) in nine European Union countries. Our findings suggest that, in general, the association is negative for women and nonexistent for men. Moreover, once we decompose household income into “own labor earnings” and “other household income”, we find that the different relationship for men and women appears to be driven by the negative relationship between BMI and “own labor earnings” for women.

Link

February 07, 2009

Publication of Y-STR haplotypes from northern Greece

Forensic Science International: Genetics doi:10.1016/j.fsigen.2009.01.001

Population genetics of Y-chromosome STRs in a population of Northern Greeks

Leda Kovatsi et al.

Abstract

Seventeen Y STR loci were typed in a population sample of 191 unrelated male individuals from Northern Greece. Haplotypes are presented for the following loci: DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439, DYS635, DYS392, Y GATA H4, DYS437, DYS438 and DYS448. The overall haplotype diversity was 0.9992. This database study provides significant additional information for the application of Y-chromosomal STRs to forensic identification efforts in Greece by nearly doubling both the number of individuals and the number of Y-loci typed from Greek populations. These samples have been previously typed for autosomal STRs [L. Kovatsi, T.J. Parsons, R.S. Just, J.A. Irwin, Genetic variation for 15 autosomal STR loci (PowerPlex 16) in a population sample from northern Greece, Forensic Sci. Int. 159 (2006) 61–63] and the mitochondrial DNA control region [J. Irwin, J. Saunier, K. Strouss, C. Paintner, T. Diegoli, K. Sturk, L. Kovatsi, A. Brandstatter, M.A. Cariolou, W. Parson, T.J. Parsons, Mitochondrial control region sequences from northern Greece and Greek Cypriots, Int. J. Legal Med. 122 (2008) 87–89].

Link

February 05, 2009

Common origin and differential admixture in Western Central African pygmies

The coverage of this at News at Nature is quite clear.

Current Biology doi:10.1016/j.cub.2008.12.049

Origins and Genetic Diversity of Pygmy Hunter-Gatherers from Western Central Africa

Paul Verdu et al.

Abstract

Central Africa is currently peopled by numerous sedentary agriculturalist populations neighboring the largest group of mobile hunter-gatherers, the Pygmies [1,2,3]. Although archeological remains attest to Homo sapiens' presence in the Congo Basin for at least 30,000 years, the demographic history of these groups, including divergence and admixture, remains widely unknown [4,5,6]. Moreover, it is still debated whether common history or convergent adaptation to a forest environment resulted in the short stature characterizing the pygmies [2,7]. We genotyped 604 individuals at 28 autosomal tetranucleotide microsatellite loci in 12 nonpygmy and 9 neighboring pygmy populations. We found a high level of genetic heterogeneity among Western Central African pygmies, as well as evidence of heterogeneous levels of asymmetrical gene flow from nonpygmies to pygmies, consistent with the variable sociocultural barriers against intermarriages. Using approximate Bayesian computation (ABC) methods [8], we compared several historical scenarios. The most likely points toward a unique ancestral pygmy population that diversified 2800 years ago, contemporarily with the Neolithic expansion of nonpygmy agriculturalists [9,10]. Our results show that recent isolation, genetic drift, and heterogeneous admixture enabled a rapid and substantial genetic differentiation among Western Central African pygmies. Such an admixture pattern is consistent with the various sociocultural behaviors related to intermariages between pygmies and nonpygmies.

Link